Forensic Science International
Volume 183, Issue 1 , Pages 20-23, 10 January 2009

A novel method for the identification of saliva by detecting oral streptococci using PCR

  • Hiroaki Nakanishi

      Affiliations

    • Forensic Science Laboratory of Yamanashi Prefectural Police H.Q., 312-4 Kubonakajima, Isawa, Fuefuki, Yamanashi 406-0036, Japan
    • Department of Forensic Medicine, Saitama Medical University, 38 Morohongo, Moroyama, Saitama 350-0495, Japan
    • Corresponding Author InformationCorresponding author at: Forensic Science Laboratory of Yamanashi Prefectural Police H.Q., 312-4 Kubonakajima, Isawa, Fuefuki, Yamanashi 406-0036, Japan. Tel.: +81 55 262 0082; fax: +81 55 262 0082.
    • ,
  • Akira Kido

      Affiliations

    • Department of Legal Medicine, Faculty of Medicine, University of Yamanashi, 1110 Shimokato, Chuo, Yamanashi 409-3898, Japan
    • ,
  • Takeshi Ohmori

      Affiliations

    • National Research Institute of Police Science, 6-3-1 Kashiwanoha, Kashiwa, Chiba 277-0882, Japan
    • ,
  • Aya Takada

      Affiliations

    • Department of Forensic Medicine, Saitama Medical University, 38 Morohongo, Moroyama, Saitama 350-0495, Japan
    • ,
  • Masaaki Hara

      Affiliations

    • Department of Forensic Medicine, Saitama Medical University, 38 Morohongo, Moroyama, Saitama 350-0495, Japan
    • ,
  • Noboru Adachi

      Affiliations

    • Department of Legal Medicine, Faculty of Medicine, University of Yamanashi, 1110 Shimokato, Chuo, Yamanashi 409-3898, Japan
    • ,
  • Kazuyuki Saito

      Affiliations

    • Department of Forensic Medicine, Saitama Medical University, 38 Morohongo, Moroyama, Saitama 350-0495, Japan

Received 22 January 2008; received in revised form 30 June 2008; accepted 1 October 2008. published online 05 November 2008.

Article Outline

Abstract 

We have used DNA amplification methods to detect common oral bacterial strains to test for the presence of saliva in forensic samples. Streptococcus salivarius and Streptococcus mutans were detected in various forms of saliva samples, whereas these streptococci were not detected in semen, urine, vaginal fluid, or on skin surfaces. Therefore, we demonstrated that these streptococci are promising new marker for the forensic identification of saliva. Our data indicated that S. salivarius is more reliable than S. mutans as an indicator of saliva presence, because the detection rates for S. salivarius and S. mutans by this method were 100% and 90%, respectively. Furthermore, S. salivarius was detected in all saliva stain samples, whereas S. mutans was only identified in 60% of the stains. Finally, using this method we were able to successfully detect S. salivarius and S. mutans in mock forensic samples. We therefore suggested that this method is useful for the identification of saliva in forensic science.

Keywords: PCR, Saliva, Streptococcus salivarius, Streptococcus mutans

 

Back to Article Outline

1. Introduction 

Recent developments in forensic practices have contributed to the investigation of crimes and the verification of criminal identity. The discrimination of body fluids in forensic examinations is important to determine the events that took place at a crime scene. The detection of saliva is particularly important for understanding the details of a crime. For example, the detection of a criminal's saliva left on a victim's skin provides evidence that the criminal had contact with a victim. Furthermore, the criminal's DNA may be isolated from the saliva, thereby verifying identity. The conventional method for testing for the presence of saliva is still a test for the presence of α-amylase [1], [2]. However, α-amylase may be present in other body fluids such as urine, and semen [3], [4]. Therefore, it is necessary to develop a new assay that can reliably discriminate saliva from other body fluids. An RNA-based assay targeting saliva-specific gene expression products was recently reported [5]. We also aimed to establish a further assay system for saliva that does not depend on α-amylase.

Numerous bacteria exist in the oral cavity. For example, the average total microscopic count is approximately 750 million oral bacterial cells per milliliter of saliva [6]. Of these, streptococci are the most abundant [7]. Specifically, Streptococcus salivarius is one of the most common streptococci in oral bacteria [6], and S. mutans is the prime causative bacterium for dental caries [8]. The detection and identification of oral bacteria has generally been performed by culturing samples on nutritive media. However, methods that incorporate the polymerase chain reaction (PCR) have recently been used to detect and identify oral bacteria such as S. salivarius or S. mutans, and have been applied in the diagnosis of caries risk [9], [10], [11], [12], [13], [14], [15].

With respect to forensics, the detection of oral streptococci has only been used to verify bite marks [16], [17], [18]. However, these reports did not discuss the identification of saliva presence. If it were possible to detect the presence of oral-specific bacteria by PCR from a forensic specimen, this could be used to verify the presence of saliva. Therefore, we evaluated whether the detection of S. salivarius and S. mutans by PCR is sufficient to confirm saliva presence.

Back to Article Outline

2. Materials and methods 

2.1. Samples 

Saliva, semen, and urine samples were collected from 20 healthy donors, and saliva stain samples were made by licking filter paper. Skin bacteria were collected from 20 healthy donors by wiping the skin with a wet cotton swab. Vaginal fluid samples were collected from 9 healthy donors by cotton swabbing. Informed consent was obtained from all participants who provided samples.

The bacterial strains used in this study were S. salivarius ATCC 13419, S. mutans ATCC 35668, S. mitis ATCC 6249, S. sanguinis ATCC 10556, Bacillus subtilis ATCC 6633, Escherichia coli ATCC 35218, Pseudomonas aeruginosa ATCC 27853, Serratia marcescens ATCC 8100, and Staphylococcus aureus ATCC 25923. These strains were purchased from Microbiologics (St. Cloud, MN). The streptococci were cultured in Mitis-Salivarius agar (BHI, Difco Laboratories, Detroit, MI), and the remaining bacteria were cultured in Nutrient agar (BHI).

2.2. DNA extractions 

For the DNA extractions, we used 50μl of body fluid, 5-mm×5-mm filter paper, or a swab in 50μl of water. Control bacteria were suspended in 50μl of water. Samples were boiled at 98°C in micro-centrifuge tubes. To lyse the bacterial cells, samples were incubated with 100μl of 200U/ml mutanolysin (Sigma, St. Louis, MO) and 20μl of 100mg/ml lysozyme (Sigma) at 50°C for 60min, followed by treatment with 20μl of Proteinase K (Qiagen, Tokyo, Japan) and 180μl of Buffer ATL (Qiagen) at 56°C for 60min. We then added 200μl of Buffer AL (Qiagen) before incubating at 70°C for 10min and adding 200μl of ethanol. The DNA was purified using a QIAamp® Mini Kit (Qiagen) according to manufacturer's protocol and eluted with 150μl of water, which was later concentrated to 30μl.

2.3. PCR conditions 

The oligonucleotide primers used in this study were designed by Hoshino et al. [9] and are listed in Table 1. PCR was carried out in 20μl reaction mixtures containing 0.5U AmpliTaqGold DNA polymerase (Applied Biosystems, Foster city, CA), 0.5μM oligonucleotide primers, template DNA, and Gold STAR 10× Buffer (Promega, Madison, WI). PCR amplification was performed in a GeneAmp PCR system 9700 (9600 emulation mode; Applied Biosystems) programmed for 11min at 95°C and 35 cycles of 1min at 94°C for denaturation, 1min at 65°C for annealing, and 1min at 72°C for extension. Identical PCR conditions were applied for both primer sets. PCR products were identified by 2.0% agarose gel electrophoresis after staining with SYBR Green I (TaKaRa, Kyoto, Japan).

Table 1. Primer sequences used in this study.
TargetNameSequence (5′-3′)Fragment Size (bp)
S. salivaliusMKK-FGTGTTGCCACATCTTCACTCGCTTCGG544
MKK-RCGTTGATGTGCTTGAAAGGGCACCATT

S. mutansMKD-FGGCACCACAACATTGGGAAGCTCAGTT433
MKD-RGGAATGGCCGCTAAGTCAACAGGAT

2.4. Conventional α-amylase detection 

The starch-agarose method was used as a conventional form of α-amylase detection. One tablet of the Neo-Amylase Test (Daiichi Pure Chemicals, Tokyo, Japan) was crushed and suspended in 50ml of 1.0% agarose gel solution. The solution was then poured onto a glass and gelled by cooling. A specimen cut out 5-mm×5-mm was placed on the gel and incubated at 37°C. A positive result was defined as the detection of digested starch after 2h.

2.5. Forensic specimens 

We used following samples as mock forensic samples to test the forensic application of our methods; 10 of cigarette butts, 10 of cotton gauzes wiping licked skin, six of saliva stains stored for 6 years on filter paper, and a mixture stain of semen and saliva (10:1 by volume) on filter paper. We also used saliva swabs from 3 dogs and one cat as common animals and examined whether S. salivarius and S. mutans are detected in animals using our methods. We attempted to extract a DNA from 2-mm×2-mm and 5-mm×5-mm of cigarette butt, and 5-mm×5-mm of gauze, swab and filter paper.

Back to Article Outline

3. Results 

3.1. Primer specificity 

To evaluate the specificity of the two primers sets used in this study (i.e., S. salivarius-specific primers and S. mutans-specific primers), DNA obtained from five species of well-known environmental bacteria and four species of oral streptococci were amplified by PCR using 1ng of the template DNA. Each primer pair specifically amplified the DNA of the target bacteria, but did not amplify DNA of other bacteria. The size of the PCR product obtained from S. salivarius and S. mutans (∼500bp) corresponded to the expected DNA fragment size reported by Hoshino et al. (544bp and 433bp, respectively) [9].

3.2. Sensitivity of detection 

The sensitivity of this method was evaluated using the purified DNA from S. salivarius and S. mutans. Chromosomal DNA serially diluted from 1ng to 500fg was used as template DNA. The detection limits for S. salivarius and S. mutans were 10pg (corresponding to the amount of DNA in approximately 5.0×103 bacteria) and 1pg (corresponding to the amount of DNA in approximately 4.5×102 bacteria), respectively (Fig. 1).

  • View full-size image.
  • Fig. 1. 

    Sensitivity of the PCR method, examined using purified chromosomal DNA from (a) S. salivarius and (b) S. mutans. The amount of template DNA used in each lane was as follows: lane M, 100-bp molecular mass marker; lane 1, 1ng; lane 2, 100pg; lane 3, 50pg; lane 4, 25pg; lane 5, 10pg; lane 6, 5pg; lane 7, 2.5pg; lane 8, 1pg; lane 9, 500fg.

3.3. Detection of S. salivarius and S. mutans from various body samples 

Species-specific PCR products were successfully identified in the saliva samples, and no non-specific bands were observed. The PCR results for S. salivarius and S. mutans identification from various body fluids and skin swabs are shown in Table 2. S. salivarius was identified in all saliva samples tested in this study, whereas S. mutans was not detected in 10% of the saliva samples. Both species were detected in saliva but not in semen, urine, vaginal fluid, or skin.

Table 2. The PCR results for S. salivarius and S. mutans identification from various body fluids and skin swabs.
SamplenS. salivariusS. mutans
DetectedNot detectedDetectedNot detected
Saliva20200182
Semen20020020
Urine20020020
Vaginal fuild90909
Skin20020020

3.4. Detection of S. salivarius and S. mutans from saliva stains 

Table 3 shows the PCR results of S. salivarius and S. mutans identification from saliva stain samples. S. salivarius was detected in all saliva stain samples as well as liquid saliva samples, whereas S. mutans was only detected in 60% of saliva stain samples. Fig. 2 shows representative results of the PCR products from the saliva stain samples. Individual differences were observed in the degree of detection (i.e., the intensity of the bands) of the PCR products for both bacteria.

Table 3. The PCR results for S. salivarius and S. mutans identification from human saliva stain samples.
SpeciesnDetectedNot detected
S. salivarius20200
S. mutans20128
  • View full-size image.
  • Fig. 2. 

    Representative results for the detection of (a) S. salivarius and (b) S. mutans from saliva stain samples using PCR. Lane M, 100-bp molecular mass marker; lane 1, donor No. 1; lane 2, donor No. 2; lane 3, donor No. 3; lane 4, donor No. 4; lane 5, donor No. 5.

3.5. Forensic applications 

Table 4 shows the PCR results of S. salivarius and S. mutans identification from cigarette butts, cotton gauzes wiping licked skin, and 6-years stored saliva stains. For 5-mm×5-mm of cigarette butt, S. salivarius was detected in 9 of 10 samples and S. mutans was detected in 8 of 10 samples. Additionally, the number of detected sample of S. salivarius and S. mutans from 2-mm×2-mm of cigarette butt was 8 and 5, respectively. For cotton gauzes wiping licked skin, S. salivarius was detected in 8 of 10 samples and S. mutans was detected in 5 of 10 samples. Either streptococcus was detected in a mixture of semen and saliva. For aged saliva stains that had been stored for 6 years, S. salivarius was detected in 5 of 6 samples and S. mutans was detected in 4 of 6 samples. All of these samples were also tested using the starch-agarose method, and all samples gave positive results. On the other hand, neither S. salivarius nor S. mutans were detected in the saliva of 3 dogs and one cat.

Table 4. The PCR results for S. salivarius and S. mutans identification from various mock forensic samples.
SamplenS. salivariusS. mutans
DetectedNot detectedDetectedNot detected
Cigarette butt (5-mm×5-mm)109182
Cigarette butt (2-mm×2-mm)108255
Cotton gauze that wiped licked skin108255
Saliva stain stored for 6 years65142

Back to Article Outline

4. Discussion 

We did not detect S. salivarius or S. mutans in semen, urine, vaginal fluid, or skin surface samples, but did verify their presence in saliva. Our data suggest that the PCR-based identification of these streptococci is sufficient to demonstrate the presence of saliva. Although there was variation in the amount of PCR product detected, the sensitivity of this method was almost consistent with the data reported by Hoshino et al. [9]. Nine vaginal fluid samples were examined and no false positive results were observed. The investigation of vaginal flora, particularly streptococci, has been previously reported [19], [20]. Specifically, Rabe et al. tested vaginal flora from 487 pregnant women, and showed that the existence rates of S. salivarius and S. mutans were 2% and 0.2%, respectively [19]. Similarly, Egido et al. reported that the existence rate of S. salivarius was 1.7% in 195 vaginal fluid samples [20]. Therefore, in cases of mixed saliva and vaginal fluid, an examiner must carefully evaluate the results.

Given that our detection rates for S. salivarius and S. mutans were 100% and 90%, respectively, our results suggest that S. salivarius is more reliable than S. mutans as a target species for the identification of liquid saliva. Furthermore, the detection rate of S. mutans was only 60% in the saliva stains. S. salivarius is mainly found on the dorsum linguae, whereas S. mutans inhabits dental plaques [21]. The difference in detection rates is likely due to these differences in location. It is therefore expected that S. salivarius inhabiting the dorsum linguae would be especially useful for verifying the presence of saliva in samples, e.g., when wiped from a victim's skin with gauze.

We detected neither S. salivarius nor S. mutans in saliva samples from dog or cat. In accordance with previous studies, neither of bacteria was found in dog [22], cat [23], pig [23] and goat [23]. However, Scannapieco et al. reported resembled S. salivarius was isolated from a dog [23], and Fujita et al. reported S. mutans was isolated from 2 dogs having caries [24]. That is, dog may have S. salivarius and S. mutans in rare case. Moreover, oral streptococci may be found in other animals. Thus, an examiner must carefully evaluate the results when forensic saliva samples might have been contaminated by animal saliva.

Using this method, we were able to detect the presence of S. salivarius and S. mutans in sufficient number of mock forensic samples in which α-amylase was also detected by conventional starch-agarose gel method. However, this method could not detect these bacteria from some of mock samples. This may be due to an individual variation of oral bacteria inhabiting. As described above, a variation in the amount of PCR product detected has been observed among the subjects.

Chromosomal DNA extracted from forensic materials is generally a very small amount and is occasionally degraded by factors such as septicity and ultraviolet rays. In this study, we could show that these two streptococci are sufficient to indicate the presence of saliva but we consider that this method may be improved by combining to other detecting technology or by designing new primer sets with smaller amplicons that can be used in cases of extremely degraded saliva samples.

Back to Article Outline

Acknowledgement 

The authors would like to express their gratitude to Dr. Yoshihito Fujinami (National Research Institute of Police Science) for his guidance and support on bacteria issue.

Back to Article Outline

References 

  1. Willott GM. An improved test for the detection of salivary amylase in stains. J. Forensic Sci. Soc. 1974;14:341–344
  2. Schill BW, Schumaker GFB. Radial diffusion in gels for micro determination of enzymes. Anal. Biochem. 1972;46:502–533
  3. Tsutsumi H, Higashide K, Mizuno Y, Tamaki K, Katsumata Y. Identification of saliva stains by determination of the specific activity of amylase. Forensic Sci. Int. 1991;50:37–42
  4. Quarino L, Dang Q, Hartmann J, Moynihan N. An elisa method for the identification of salivary amylase. J. Forensic Sci. 2005;50:873–876
  5. Juusola J, Ballantyne J. mRNA profiling for body fluid identification by multiplex quantitative RT-PCR. J. Forensic Sci. 2007;52:1252–1262
  6. Burnett GW, Scherp HW, Schuster GS. Oral Microbiology and Infectious Disease Fourth Edition. Baltimore: The Williams & Wilkins Company; 1976;
  7. Socransky SS, Manganiello SD. The oral microbiota of man from birth to senility. J. Periodontol. 1971;42:485–496
  8. Loesche WJ. Role of Streptococcus mutans in human dental decay. Microbiol. Rev. 1986;50:353–380
  9. Hoshino T, Kawaguchi M, Shimizu N, Hoshino N, Ooshima T, Fujiwara T. PCR detection and identification of oral streptococci in saliva samples using gtf genes. Diagn. Microbiol. Infect. Dis. 2004;48:195–199
  10. Sato T, Matsuyama J, Kumagai T, Mayanagi G, Yamamura M, Washino J, et al. Nested PCR for detection of mutans streptococci in dental plaque. Lett. Appl. Microbiol. 2003;37:66–69
  11. Yoshida A, Suzuki N, Nakano Y, Kawada M, Oho T, Koga T. Development of a 5′ nuclease-based real-time PCR assay for quantitative detection of cariogenic dental pathogens streptococcus mutans and streptococcus sobrinus. J. Clin. Microbiol. 2003;41:4438–4441
  12. Yano A, Kaneko N, Ida H, Yamaguchi T, Hanada N. Real-time PCR for quantification of Streptococcus mutans. FEMS Microbiol. Lett. 2002;217:23–30
  13. Oho T, Yamashita Y, Shimazaki Y, Kushiyama M, Koga T. Simple and rapid detection of Streptococcus mutans and Streptococcus sobrinus in human saliva by polymerase chain reaction. Oral Microbiol. Immunol. 2000;15:258–262
  14. Rupf S, Merte K, Eschrich K. Quantification of bacteria in oral samples by competitive polymerase chain reaction. J. Dent. Res. 1999;74:850–856
  15. Igarashi T, Yano Y, Yamamoto A, Sasa R, Goto N. Identification of Streptococcus salivarius by PCR and DNA probe. Lett. Appl. Microbiol. 2001;32:394–397
  16. Elliot TR, Rogers AH, Haverkamp JR, Groothuis D. Analytical pyrolysis of Streptococcus salivarius as an aid to identification in bite-mark investigation. Forensic Sci. Int. 1984;26:131–137
  17. Brown KA, Elliot TR, Rogers AH, Thonard JC. The survival of oral streptococci on human skin and its implication in bite-mark investigation. Forensic Sci. Int. 1984;26:193–197
  18. Rahimi M, Heng NC, Kieser JA, Tompkins GR. Genotypic comparison of bacteria recovered from human bite marks and teeth using arbitrarily primed PCR. J. Appl. Microbiol. 2005;99:1265–1270
  19. Rabe LK, Witerscheid KK, Hiller SL. Association of viridans group streptococci from pregnant women with bacterial vaginosis and upper genital tract infection. J. Clin. Microbiol. 1988;26:1156–1160
  20. Egido JM, Maestre JR, Peña Izquierdo MY. The isolation of streptococcus morbillorum from vaginal exudates. Rev. Soc. Bras. Med. Trop. 1995;28:117–122
  21. Wannamaker LW, Matsen JM. Streptococci and Streptococcal Diseases. New York, London: Academic Press; 1972;
  22. Takada K, Hayashi K, Sasaki K, Sato T, Hirasawa M. Selectivity of Mitis Salivarius agar and a new selective medium for oral streptococci in dogs. J. Microbiol. Methods. 2006;66:460–465
  23. Scannapieco FA, Solomon L, Wadenya RO. Emergence in human dental plaque and host distribution of amylase-binding streptococci. J. Dent. Res. 1994;73:1627–1635
  24. Fujita K, Tonokura M, Hanada S, Takayanagi H, Mitsumura M, Tsuchiya A, et al. Two cases of dental caries on the maxillary first molar in small dogs. J. Anim. Clin. Med. 2001;10:23–26

PII: S0379-0738(08)00386-1

doi:10.1016/j.forsciint.2008.10.003

Forensic Science International
Volume 183, Issue 1 , Pages 20-23, 10 January 2009

Article Tools

* Image Usage & Resolution